Yazdır

İstanbul’da Kan Donörlerinde TT Virüsü (TTV) Prevalansının Araştırılması

Semra TUNÇBİLEK*, Diler COŞKUN**, Fuat ÇETİNKAYA***, Nedret HIZEL*, Pelin TAHTAKILIÇ*


    *  Genom Moleküler Tanı Laboratuvarı, ANKARA

  **  Haydarpaşa Numune Hastanesi, İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Kliniği,

***  Haydarpaşa Numune Hastanesi, Kan Bankası, İSTANBUL

ÖZET

Bu çalışmada 68 (%34)’i Haydarpaşa Numune Hastanesi Kan Merkezi’nden, 132 (%66)’si Kızılay Zeynep Kamil Kan Merkezi’nden olmak üzere, İstanbul’da toplam 200 kan donöründe "semi-nested" polimeraz zincir reaksiyonu yöntemi ile TT virüsü-DNA’sı araştırılmıştır. Onar serum örneği içeren 20 havuz hazırlanmış, bunların sekizinde pozitif sonuç alınmış ve bu havuzların içeriğinde yer alan serumlar tek tek açıldığında, toplam dokuz (%4.5) serumun TTV-DNA’sı içerdiği belirlenmiştir. Bu, ülkemizde kan donörlerinde TT virüsü prevalansının araştırıldığı ilk çalışmadır. Bir yandan epidemiyolojik çalışmalar sürdürülürken, bir yandan da TT virüsünün hepatik ve ekstrahepatik hastalıklarla ilişkisinin belirlenmesi gerekmektedir.

Anahtar Kelimeler: TT virüsü, Prevalans, "Semi-nested" polimeraz zincir reaksiyonu

SUMMARY

Determination of TT Virus (TTV) Prevalence in Blood Donors in İstanbul

In this study, TT virus-DNA was detected in the sera of 200 blood donors in İstanbul, 68 (34%) from Haydarpaşa Numune Hospital and 132 (66%) from Red Crescent Zeynep Kamil blood centers, by semi-nested polymerase chain reaction method. A total of 20 pools, each containing 10 serum samples were prepared. Eight pools were positive by initial screening, among which 9 individual samples were found to contain TTV-DNA by further analysis. This is the first study which determines the prevalence of TT virus in our country. Besides epidemiological studies, it’s also necessary to determine the relation of TT virus with hepatic and extra hepatic diseases.

Key Words: TT Virus, Prevalence, Semi-nested polimerase chain reaction

Günümüzde bilinen viral markerlerin gösterilemediği akut ve kronik hepatitlerin varlığı devam ederken, etyolojiden sorumlu olası farklı viral ajanların araştırılması moleküler biyolojik yöntemler ile gerçekleştirilmektedir.

Son olarak 1997 yılında Japonya’da etyolojisi bilinmeyen post-transfüzyon hepatitli bir olgunun (TT) serumundan, bilinen nükleik asit dizileri ile çok zayıf homoloji gösteren yeni bir viral klon izole edilmiş, polimeraz zincir reaksiyonu (PZR) ile bu dizilerin oligonükleotid primerleri belirlenmiştir. TTV (TT Virus= TT Virüsü) olarak adlandırılan bu virüsün nükleik asitleri DNaz I’e duyarlı bulunduğundan, bir DNA virüsü olduğu düşünülmüştür. İndeks olgu dahil, post-transfüzyon ne-A-G hepatitli beş olgunun üçünün serumlarında TTV-DNA’sı tespit edilmiş, TTV-DNA’sı düzeyi üç olguda aminotransferaz düzeyleriyle ilişkili bulunmuş ve TTV’nin post-transfüzyon ne-A-G hepatitlerinden sorumlu yeni bir virüs olabileceği öne sürülmüştür[1].

Tüm dünyada halen TTV ile ilgili gerek epidemiyolojik, gerekse karaciğer patolojisindeki yerini araştıran çalışmalar devam etmektedir. Ülkemizde çeşitli hasta gruplarında TTV’nin araştırıldığı bir çalışma başlatılmış[2] ancak toplumdaki prevalansı henüz tespit edilmemiştir.

Bu çalışma, İstanbul’da kan donörlerinde TTV prevalansını PZR ile araştırmak amacıyla yapılmıştır.

MATERYAL ve METOD

Bu çalışmada 68 (%34)’i Haydarpaşa Numune Hastanesi (HNH) kan merkezi, 132 (%66)’si Kızılay Zeynep Kamil (KZK) kan merkezi olmak üzere İstanbul’da toplam 200 kan donörünün serumunda semi-nested PZR ile TTV-DNA’sı araştırılmıştır.

DNA’nın Saflaştırılması

Her serum örneğinden 50 µL olacak şekilde, 10’ar serum içeren havuzlar 2 mL ependorf tüpler içinde karıştırılmıştır. Havuzlar, 0.1 mg/mL proteinaz-K içeren ve son konsantrasyonları 150 mM NaCl, 25 mM EDTA, 10 mM Tris-HCl pH: 8.0, %0.5 SDS şeklinde olan lizis solüsyonu içinde 55°C’de bir gece inkübe edilmiştir. Fenol-kloroform ekstraksiyonu ve etanolde presipitasyon sonrası DNA çökeleği 50 µL TE tampon (10 mM Tris-HCl, pH: 8.0, 1 mM EDTA) ile süspanse edilmiştir. DNA süspansiyonundan 5 µL’si birinci tur amplifikasyonda kullanılmıştır.

PZR: Birinci tur amplifikasyon, 50 mM KCl, 10 mM Tris-HCl pH: 8.3, 2.5 mM MgCl2, 50 pmol dış set primerler (NG059: 5¢- ACAGACAGAGGAGAAGG CAACATG -3¢, NG63: 5¢- CTGGCATTTTACCATTTCCAAAGTT -3¢), 1 ünite taq polimeraz (DNAmp Ltd; İngiltere) içeren toplam 50 µL’lik karışım içinde gerçekleştirilmiştir. Reaksiyon karışımları “thermal cycler” içinde (Ependorf, Master Cycler Personal, Almanya) 30 saniye-94°C, 45 saniye-60°C ve 1.5 dakika-72°C basamaklarından oluşan 30 döngüye alınmıştır. Birinci tur amplifikasyon ürününden 5 µL’si NG63 ve NG61 primerlerini (NG61: 5¢- GGCAACATGTTATGGATAGACTGG -3’) içeren reaksiyon karışımı içinde yukarıdaki ısı basamaklarını içeren ikinci tur amplifikasyonuna alınmıştır. Amplifikasyon sonuçları, ikinci tur amplifikasyon ürününden 10 µL’sinin %2’lik agaroz jelde elektroforezi ve etidyum bromid boyamayı takiben 271-baz çiftlik bölgeye karşılık gelen bandın UV transiluminator altında aranması ile analiz edilmiştir (Resim 1).

Pozitif havuzların içeriğinde yer alan serumların her birinden 500 µL alınarak, yukarıdaki DNA saflaştırma yöntemi ile tekrar DNA hazırlanmış ve PZR gerçekleştirilmiştir[3].

BULGULAR

“Semi-nested” PZR yöntemi ile yapılan testler sonucunda 200 serumdan hazırlanmış 20 havuzun sekizinde ikinci tur PZR sonrası beklenen yerinde amplifikasyon ürünü alınmıştır. Bu havuzların içeriğinde yer alan serumlar tek tek açıldığında pozitif saptanan bir havuzun içerdiği serum örnekleri negatif bulunmuş, beş havuzdan birer ve iki havuzdan ikişer serum olmak üzere toplam dokuz serum örneğinin TTV DNA’sı içerdiği belirlenmiş, 200 donörü içeren bu çalışmada TTV prevalansı %4.5 olarak bulunmuştur.

İkiyüz olgunun 7 (%3.5)’si kadın, 193 (%96.6)’ü  erkektir. Dokuz serum örneğinin dördü HNH, beşi KZK kan merkezlerine aittir. TTV-DNA’sı pozitif bulunan olguların hepsi erkektir. İkiyüz serum örneğinin 3 (%1.5)’ünde HBsAg, 1 (%0.5)’inde antiHCV pozitifliği olduğu halde, TTV-DNA’sı pozitif bulunan olguların hiçbirisinde HBsAg veya antiHCV pozitifliği tespit edilmemiştir.

TARTIŞMA

İstanbul’da kan donörlerinde TTV prevalansı %4.5 olarak bulunmuştur. Bu, ülkemizde kan donörlerinde TTV prevalansının araştırıldığı ilk çalışmadır.

Dünya literatürü incelendiğinde kan donörlerinde TTV prevalansının %1 ile %62 arasında değiştiği görülmektedir. Kan donörlerinde TTV prevalansı Amerika Birleşik Devletleri (ABD)’nde %1[4], İskoçya’da %1.9[5], Tayland’da iki ayrı çalışmada %7[6] ve %36[7], Japonya’da %12[8], Kore’de %14 ve %19.2[9], Pakistan’da %16[8], İtalya’da %22[10], Brezilya’da %62[11] olarak bildirilmiştir. Taşra halkını içeren belli çalışmalar da gözönüne alındığında, bazı ülkelerde TTV prevalansının %83’e kadar yükseldiği görülmekte, prevalansın özellikle Afrika’daki ülkelerde ve Brezilya’da çok yüksek olduğu dikkati çekmektedir[5]. Tablo 1’de çeşitli ülkelerdeki TTV prevalansları yer almaktadır.

TTV ilk defa Japonya’da “TT” isimli post-transfüzyon ne-A-G hepatitli bir olgunun serumundan izole edilmiş ve hastanın ismine gönderme yapılarak “TT Virüsü” olarak adlandırılmıştır. TT aynı zamanda “transfusion transmitted (transfüzyonla bulaşan)” sözcükleriyle de uyumludur. İtalya’da Prati ve arkadaşlarınca gerçekleştirilen prospektif bir çalışmada TTV infeksiyon oranı yüksek bulunmuş, ancak sağlıklı donörlerde de rastlanan yüksek viremi oranı, yazarlara bulaşın, sadece parenteral yolla olmadığını düşündürmüştür[10]. TTV infeksiyonunun endemik olduğu Kongo Demokratik Cumhuriyeti’nde Davidson ve arkadaşları antenatal bir klinikte 105 kadının 61 (%58)’inde, 68 infantın ise 36 (%54)’sında TTV-DNA’sını saptamışlardır. Çalışmada infantların çoğu üç ay ve öncesinde pozitif bulunmuşlardır. İlginç olarak TTV-DNA’sı negatif annelerin bebeklerinde de pozitiflik tespit edilmiş ve yazarlarca TTV’nin hepatit A ve diğer enterik bulaşan virüsler gibi çevreden alınabileceği öne sürülmüştür[12]. Ukita ve arkadaşları da TTV viremili beş olgunun beşinin safrasında TTV-DNA’sı saptamışlar, TTV’nin safra ile dışkıya atılarak fekal-oral yolla toplumu infekte edebileceğini öne sürmüşlerdir[13]. Okamoto ve arkadaşları ise TTV-DNA’sı pozitif post-transfüzyon ne-A-G hepatitli beş olgunun üçünün dışkılarında TTV pozitifliği saptamışlar; serum ve dışkının sekans analizleri sonucu aynı virüs olduklarını göstererek, TTV’nin sadece parenteral değil, enteral de bulaşabileceğini bildirmişlerdir[14]. TTV’nin ayrıca, transfüzyonla bulaşan GB virüs C (GBV-C) ile birliktelik göstermediği bildirilmektedir[15]. Bütün bu çalışmalar, TTV’nin sadece parenteral değil, enteral de bulaşabileceğini destekler niteliktedir. Bu da bazı toplumlarda rastlanan yüksek prevalansı açıklamaktadır.

TTV ile ilgili mevcut diğer epidemiyolojik çalışmalar değerlendirildiğinde; vireminin yaş ile arttığı [5,16,17], HIV ko-infeksiyonu olmadığı[16], bulaşın nadiren cinsel yolla veya intravenöz ilaç kullanımı ile olduğu[16], hemodiyaliz ile bulaşın pek olası gibi görünmediği[17] bildirilmektedir.

Çalışmamızda TTV-DNA’sı pozitif serumların hiçbirisinde HBsAg veya antiHCV pozitifliği bulunmamıştır. TTV’nin parenteral bulaşan diğer virüslerle birlikteliğinin olup olmadığının ortaya konulması da araştırılmaya muhtaçtır.

Bu zarfsız, tek sarmallı DNA virsünün başlangıçta parvovirüslerin bir üyesi olduğu düşünülmüştür[8]. Mushahwar ve arkadaşları farklı biyokimyasal ve moleküler özellikler gösteren TTV’yi “Circinoviridae” olarak adlandırdıkları yeni bir familyanın üyesi kabul etme eğilimi gösterirlerken[18], Miyata ve arkadaşları CAV (chicken anemia virus) gibi sirküler bir virüs olduğunu gösterdikleri bu ajanın ilk insan “Circovirus”u olabileceğini öne sürmüşlerdir[19].

TTV ilk izole edildiğinde “etyolojisi bilinmeyen post-transfüzyon hepatitlerinde yüksek transaminaz düzeyleriyle ilintili yeni bir DNA virüsü” olarak tanımlanmıştır[1]. Ancak çeşitli çalışmalarda, TTV varlığının ALT düzeyi ile ilgili olmadığı da bildirilmektedir[10,17,20,21]. Akut ve kronik karaciğer hastalıkları ile TTV’nin ilişkisini araştıran çalışmalar devam etmektedir. Tayland’da Tanaka ve arkadaşları siroz ve hepatoselüler karsinomada, kronik karaciğer hastalıkları ve sağlıklı donörlere oranla TTV prevalansını yüksek bulurlarken[7], Nakano ve arkadaşlarınca Kore’de TTV’nin kriptojenik karaciğer hastalığından sorumlu başlıca ajan olmadığı bildirilmiştir[9]. Ülkemizde Türkoğlu ve arkadaşları 13 kriptojenik kronik aktif hepatitli olgunun 5 (%38.4)’inde, 35 kriptojenik karaciğer sirozlu olgunun 6 (%17.1)’sında TTV-DNA’sını pozitif bulmuşlardır[2].

Bu çalışmada İstanbul’da kan donörlerinde TTV-DNA’sı araştırılmış ve prevalans %4.5 olarak bulunmuştur. Bu, TTV prevalansının ülkemizde kan donörlerinde araştırıldığı ilk çalışmadır ve bulunan oran hiç de düşük değildir. Epidemiyolojik çalışmaların yanısıra, TTV’nin hepatik ve ekstra-hepatik hastalıklarla ilişkisinin de belirlenmesi gerekmektedir.

TEŞEKKÜR

Başta kan bankası müdürü Dr. Şaban ÖZBAYBURTLU ve mikrobiyolog Dr. Tomris BİRKAN olmak üzere, Kızılay Zeynep Kamil Man Merkezi çalışanlarına anlayışları ve yardımları için teşekkür ederiz.

KAYNAKLAR

  1. Nishizawa T, Okamoto H, Konishi K, Yoshizawa, Miyakawa Y, Mayumi M. A novel DNA virus (TTV) associated with elevated transaminase levels in posttransfusion hepatitis of unknown etiology. Biochem Biophys Res Commun 1997;241:92-7.
  2. Türkoğlu S, Çakaloğlu Y, Şentürk H ve ark. Çeşitli hasta gruplarında yeni bir DNA virüsü (TTV)’nün araştırılması. IV. Ulusal Viral Hepatit Simpozyumu (4-6 Kasım 1998, Ankara) Program ve Kongre Kitabı, s:201.
  3. Naumov NV, Petrova EP, Thomas MG, Williams R. Presence of a newly described DNA virus (TTV) in patients with liver disease. Lancet 1998;352:195-7.
  4. Charlton M, Adjei P, Poterucha Z, et al. TT virus infection in North American blood donors, patients with fulminant hepatic failure, and cryptogenic cirrhosis. Hepatology 1998;28:839-42.
  5. Simmonds P, Davidson F, Lycett C, et al. Detection of a novel DNA virus (TTV) in blood donors and blood products. Lancet 1998;352:191-5.
  6. Poovorawan Y, Theamboonlers A, Jantaradsamee P, et al. Hepatitis TT virus infection in high-risk groups. Infection 1998;26:355-8.
  7. Tanaka H, Okamoto H, Luengrojanakul P, et al. Infection with an unenveloped DNA virus (TTV) associated with post-transfusion non-A to G hepatitis in hepatitis patients and healthy blood donors in Thailand. J Med Virol 1998;56:234-8.
  8. Prescott LE, Simmonds P and International Collaborators. Global distribution of transfusion-transmitted virus. N Eng J Med 1998;339:776-7.
  9. Nakano T, Park YM, Mizokami M, et al. TT virus infection among blood donors and patients with non-B, non-C liver diseases in Korea. J Hepatol 1999;30:389-3.
  10. Prati D, Lin YH, De Mattei C, et al. A prospective study on TT virus infection in transfusion-dependent patients with beta-thalassemia. Blood 1999;93:1502-5.
  11. Niel C, de Oliveira JM, Ross RS, Gomes SA, Roggendorf M, Viazov S. High prevalance of TT virus infection in Brazilian blood donors. J Med Virol 1999;57:259-63.
  12. Davidson F, McDonald D, Mokili JL, Prescott LE, Graham S, Simmonds P. Early acquisition of TT virus (TTV) in an area endemic for TTV infection. J Infect Dis 1999; 5:1070-6.
  13. Ukita M, Okamoto H, Kato N, Miyakawa Y, Mayumi M. Excretion into bile of a novel unenveloped DNA virus (TT Virus) associated with acute and chronic non-A-G hepatitis. J Infect Dis 1999;179:1245-8.
  14. Okamoto H, Akahane Y, Ukita M, et al. Fecal excretion of a non-enveloped DNA virus (TTV) associated with post-transfusion non-A-G hepatitis. J Med Virol 1998; 56:128-32.
  15. Desai SM, Muerhoff AS, Leary TP, et al. Prevalence of TT Virus infection in us blood donors and populations at risk for acquiring parenterally transmitted viruses. J Infect Dis 1999;179;1242-4.
  16. Mc Donald DM, Scott GR, Clutterbuck D, Simmond P. Infrequent detection of TT virus infection in intravenous drug users, prostitutes, and homosexual men. J Infect Dis 1999;179:686-9.
  17. Oguchi T, Tanaka E, Orii K, Kobayashi M, Hora K, Kiyosawa K. Transmission of and liver injury by TT virus in patients of maintenance hemodialysis. J Gastroenterol 1999;34:234-40.
  18. Mushohwar IK, Erker JC, Muerhoff AS, et al. Molecular and biophysical characterization of TT virus. Evidence for a new virus family infecting humans. Proc Natl Acad Sci USA 1999;96:3177-82.
  19. Miyata H, Tsunoda H, Kazi A, et al. Identification of a novel GC-rich 113-nucleotide region to complete the circular, single-stranded DNA genome of TT virus, the first human circovirus. J Virol 1999;73:3582-6.
  20. Kobayashi M, Chayama K, Arase Y, et al. Prevalance of TT virus before and after blood transfusion in patients with chronic liver disease treated surgically for hepatocellular carcinoma. J Gastroenterol Hepatol 1999;14:358-63.
  21. Takayama S, Miura T, Matsuo S, Taki M, Sugii S. Prevalence and persistence of a novel DNA TT Virus (TTV) infection in Japanese haemophiliacs. Br J Haemotol 1999;104:626-9.

Yazışma Adresi

Dr. Diler COŞKUN

Bakkal Sok. Orhan Bey Apt.

2/6 Acıbadem

Kadıköy - İSTANBUL

Makalenin Geliş Tarihi: 05.06.1999   Kabul Tarihi: 26.07.1999

Yazdır